Overblog
Seguir este blog Administration + Create my blog

Abogada especialista nos explica la manipulación climática y del agua según la ley

Publicado en por Skiper

Ver comentarios

SOTT Radio Network N.º 383, 9 de julio, 2022 - Rebelión de granjeros contra agenda verde

Publicado en por Skiper

Ver comentarios

Corrigen un estudio que infló las muertes infantiles por Covid usadas por el CDC

Publicado en por Skiper

Corrigen un estudio que infló las muertes infantiles por Covid usadas por el CDC

Fuente: https://cienciaysaludnatural.com/corrigen-estudio-que-inflo-las-muertes-infantiles-por-k0-b1t-usadas-por-el-cdc/

Un estudio que infló el número de muertes por COVID-19 entre niños ha sido corregido después de ser promovido por altos funcionarios de los Centros para el Control y la Prevención de Enfermedades (CDC) de EE.UU.

El artículo afirmaba falsamente que al menos 1433 muertes atribuidas principalmente al COVID-19 habían ocurrido entre los menores de 19 años en los Estados Unidos, pero el número real es 1088, reconocieron los autores en la versión actualizada (ver el pdf).

Los autores, dirigidos por el científico británico Seth Flaxman, utilizaron incorrectamente datos del Centro Nacional de Estadísticas de Salud de los CDC para la versión inicial. Dijeron que solo incluyeron muertes en las que el COVID-19 se consideró la causa subyacente o principal. Pero en realidad también contaron las muertes en las que COVID-19 figuraba como una causa contribuyente. La versión inicial «utilizó incorrectamente estos datos», dijeron los autores en el artículo actualizado.

Flaxman no respondió a una solicitud de comentarios. Los correos electrónicos revisados mostraron que no entendía cómo usar la base de datos de los CDC que enumera las muertes por COVID-19 antes de que se le dijera cómo usarla después de la publicación del estudio.

Los otros autores, todos menos uno de los cuales se encuentran fuera de los Estados Unidos, no han comentado públicamente sobre la corrección.
 

En esta imagen de video, la Dra. Katherine Fleming-Dutra de los Centros para el Control y la Prevención de Enfermedades se presenta ante el Comité Asesor de Vacunas y Productos Biológicos Relacionados de la Administración de Alimentos y Medicamentos durante una reunión virtual el 14 de junio de 2022. (FDA)

En esta imagen de video, la Dra. Katherine Fleming-Dutra de los Centros para el Control y la Prevención de Enfermedades se presenta ante el Comité Asesor de Vacunas y Productos Biológicos Relacionados de la Administración de Alimentos y Medicamentos durante una reunión virtual el 14 de junio de 2022. (FDA)

Estudio promovido por tres funcionarios de los CDC
El documento, que aún no ha sido revisado por pares, fue citado por tres funcionarios de los CDC, incluida la directora de la agencia, la Dra. Rochelle Walensky, mientras promovía la vacunación contra el COVID-19 para niños menores de 5 años en reuniones y una conferencia de prensa en junio.

“Durante marzo de 2020 hasta abril de 2022, el COVID-19 estuvo entre las cinco principales causas de muerte en cada grupo de edad de niños menores de 19 años y la causa infecciosa número uno de muerte en niños”, dijo Walensky durante una sesión informativa, poniendo las mismas cifras que se describen en el estudio.

Pero los observadores externos identificaron múltiples problemas con la investigación. El problema más importante fue incluir las muertes en las que COVID-19 no figuraba como la causa principal. Otro enumeraba las muertes acumuladas de COVID-19 frente a las muertes anualizadas de 2019 por otras causas, como «accidentes».

Los funcionarios de los CDC, la Dra. Katherine Fleming-Dutra y la Dra. Sara Oliver, citaron el documento en conversaciones con el panel asesor de vacunas de la agencia y los expertos que asesoran a la Administración de Alimentos y Medicamentos sobre vacunas. El Dr. Matthew Daley, quien preside el grupo de trabajo de vacunas COVID-19 del panel de los CDC, también lo mencionó.

Las diapositivas de PowerPoint que los funcionarios mostraron durante las reuniones mientras citaban el documento fueron ampliamente difundidas en las redes sociales por funcionarios externos como el Dr. Nirav Shah, director de los CDC de Maine, al afirmar que las vacunas contra el COVID-19 son necesarias para los niños.

El CDC, Walensky, Fleming-Dutra, Oliver y Daley no han respondido a las consultas y no han alertado al público sobre el artículo corregido. Esta estrategia de anunciar datos falsos y luego de conseguir la autorización, corregirlos, es parte de un patrón de los CDC durante la pandemia.

Cambio en los resultados
El documento inicial cubría las muertes registradas entre marzo de 2020 y abril de 2022. Los datos destacados por los funcionarios de los CDC ya estaban equivocados porque utilizaron el número acumulado de muertes relacionadas con COVID-19 en comparación con las cifras anualizadas de otras causas de muerte, como enfermedades cardíacas y otras.

Ese dato falso colocó al COVID-19 como una de las cinco principales causas de muerte para todos los niños. Anualizando las muertes por COVID-19 y comparándolas con otras cifras anualizadas, el COVID-19 obtuvo una clasificación más baja. Por ejemplo, en lugar de ser la cuarta causa principal de muerte de niños menores de un año, fue la novena causa principal de muerte para ese grupo de edad.

En la versión actualizada, los investigadores omitieron los números acumulativos. Tomaron los datos de muerte de los 12 meses a partir del 1 de abril de 2022 y compararon los números con otras causas de muerte del año 2019.

Los accidentes, el suicidio y las neoplasias malignas estaban entre los problemas que causan más muertes que el COVID-19, encontraron los investigadores. El COVID-19 figuraba como la octava causa principal de muerte entre los jóvenes de 0 a 19 años durante el tiempo estudiado. Según los datos del certificado de defunción, solo 764 muertes estaban relacionadas con la enfermedad.

Los autores sostuvieron que la amenaza que representa el COVID-19 para los niños significa que los niños deben recibir vacunas y tratamientos farmacéuticos contra el COVID-19 y que se deben usar «mitigaciones como la ventilación». En la versión anterior, dijeron que sus hallazgos “subrayan la importancia de continuar las campañas de vacunación para niños de 5 años en los EE.UU. y de vacunas efectivas contra el covid-19 para niños menores de 5 años”.

Ver comentarios

El Banco Central Europeo advierte de inflación, recesión y estanflación

Publicado en por Skiper

Ver comentarios

¿Quién es el dueño del mundo?: BlackRock y Vanguard

Publicado en por Skiper

Lazos y conexiones de BlackRock y Vanguard

Lazos y conexiones de BlackRock y Vanguard

Fuente: Mercola.com a través de https://www.organicconsumers.org/news/who-owns-world-blackrock-and-vanguard

Autor: Dr. Joseph Mercola

Traducción, corrección de la traducción y subrayado del texto relevante: Skiper

Aviso al lector: La mayoría de fuentes y enlaces del artículo original no están presentes en esta traducción pero pueden encontrarse en el artículo del Dr. Joseph Mercola.

Hasta hace poco, parecía que la competencia económica había estado impulsando el auge y la caída de pequeñas y grandes empresas en los EE.UU. Supuestamente, PepsiCo es el competidor de Coca Cola, Apple y Android compiten por su lealtad y las compañías farmacéuticas luchan por su dinero para el cuidado de la salud. Sin embargo, todo eso resulta ser una ilusión.

Desde mediados de la década de 1970, dos corporaciones, Vanguard y Blackrock, han engullido a la mayoría de las empresas del mundo, destruyendo efectivamente el mercado competitivo en el que ha descansado la fuerza de Estados Unidos, dejando atrás solo falsas apariencias.

De hecho, la economía global puede ser el truco ilusorio más grande que jamás se haya puesto ante los ojos de las personas en todo el mundo. Para comprender lo que realmente está sucediendo, mire el documental de una hora de duración de Tim Gielen, "MONOPOLY: Quien es el dueño del mundo?".

Dominación Corporativa

Como señaló Gielen, quien narra la película, un puñado de mega corporaciones (compañías de inversión privadas) dominan todos los aspectos de nuestras vidas: todo lo que comemos, bebemos, vestimos o usamos de una forma u otra. Estas empresas de inversión son tan enormes que controlan el flujo de dinero en todo el mundo. Entonces, ¿Cómo funciona este esquema?.

Si bien parece haber cientos de marcas competidoras en el mercado, al igual que las muñecas rusas, las empresas matrices más grandes poseen varias marcas más pequeñas. En realidad, todas las marcas de alimentos envasados, por ejemplo, son propiedad de una docena de empresas matrices más grandes.

Pepsi Co. posee una larga lista de marcas de alimentos, bebidas y refrigerios, al igual que Coca-Cola, Nestlé, General Mills, Kellogg's, Unilever, Mars, Kraft Heinz, Mondelez, Danone y Associated British Foods. Juntas, estas empresas matrices monopolizan la industria de los alimentos envasados, ya que prácticamente todas las marcas de alimentos disponibles pertenecen a una de ellas.

Estas empresas cotizan en bolsa y están dirigidas por juntas, donde los accionistas más grandes tienen poder sobre la toma de decisiones. Aquí es donde se pone interesante, porque cuando buscas quiénes son los mayores accionistas, encuentras otro monopolio.

Si bien los principales accionistas pueden cambiar de vez en cuando, según las acciones compradas y vendidas, dos empresas figuran constantemente entre los principales titulares institucionales de estas empresas matrices: The Vanguard Group Inc. y Blackrock Inc.

Pepsi y Coca-Cola: un ejemplo

Por ejemplo, aunque hay más de 3000 accionistas en Pepsi Co., las participaciones de Vanguard y Blackrock representan casi un tercio de todas las acciones. De los 10 principales accionistas de Pepsi Co., los tres principales: Vanguard, Blackrock y State Street Corporation, poseen más acciones que los siete restantes.

Ahora, echemos un vistazo a Coca-Cola Co., el principal competidor de Pepsi. ¿Quién es el dueño de Coca-Cola?. Al igual que con Pepsi, la mayoría de las acciones de la empresa están en manos de inversores institucionales, que ascienden a 3.155 (al momento de la realización del documental).

Como se muestra en el documental, tres de los cuatro principales accionistas institucionales de Coca-Cola son idénticos a los de Pepsi: Vanguard, Blackrock y State Street Corporation. El accionista número uno de Coca-Cola es Berkshire Hathaway Inc.

Estos cuatro, Vanguard, Blackrock, State Street y Berkshire Hathaway, son las cuatro firmas de inversión más grandes del planeta. “Entonces, Pepsi y Coca-Cola son todo menos competidores”, dice Gielen. Y lo mismo ocurre con las demás empresas de alimentos envasados. Todos son propiedad del mismo pequeño grupo de accionistas institucionales.

Monopolio de gran tecnología

El monopolio de estas firmas de inversión no está relegado a la industria de los alimentos envasados. Se los encuentra dominando virtualmente todas las demás industrias también. Tome la Big Tech, por ejemplo. Entre las 10 empresas tecnológicas más grandes encontramos a Apple, Samsung, Alphabet (empresa matriz de Google), Microsoft, Huawei, Dell, IBM y Sony.

Aquí, encontramos la misma configuración de muñeca rusa de anidación. Por ejemplo, Facebook posee Whatsapp e Instagram. Alphabet es propietaria de Google y de todos los negocios relacionados con Google, incluidos YouTube y Gmail. También es el mayor desarrollador de Android, el principal competidor de Apple. Microsoft posee Windows y Xbox. En total, solo cuatro empresas matrices producen el software utilizado por prácticamente todas las computadoras, tabletas y teléfonos inteligentes del mundo. ¿Quién, entonces, lo posee?. Aquí hay una muestra:

Facebook: más del 80 % de las acciones de Facebook están en manos de inversores institucionales, y los principales titulares institucionales son los mismos que se encuentran en la industria alimentaria: Vanguard y Blackrock son los dos principales, a finales de marzo de 2021. State Street Corporation es el quinto mayor accionista

Apple: los cuatro principales inversores institucionales son Vanguard, Blackrock, Berkshire Hathaway y State Street Corporation.

Microsoft: los tres principales accionistas institucionales son Vanguard, Blackrock y State Street Corporation.

Puede continuar revisando la lista de marcas tecnológicas (compañías que fabrican computadoras, teléfonos inteligentes, productos electrónicos y electrodomésticos) y encontrará repetidamente a Vanguard, Blackrock, Berkshire Hathaway y State Street Corporation entre los principales accionistas.

El mismo grupo pequeño es dueño de todo lo demás también

La misma tendencia de propiedad existe en todas las demás industrias. Gielen ofrece otro ejemplo más para probar que esta afirmación no es solo una exageración:

“Digamos que queremos planear unas vacaciones. En nuestra computadora o teléfono inteligente, buscamos un vuelo barato a través de sitios web como Skyscanner y Expedia, ambos propiedad del mismo grupo de inversores institucionales: Vanguard, Blackrock y State Street Corporation.

Volamos con una de las muchas aerolíneas existentes:American Airlines, Air France, KLM, United Airlines, Delta y Transavia, cuya mayoría de las acciones suelen pertenecer a los mismos inversores...

La aerolínea en la que volamos es en la mayoría de los casos un Boeing o un Airbus. Una vez más, vemos lo mismo: accionistas institucionales. Buscamos un hotel o un apartamento a través de Bookings.com o AirBnB.com. Una vez que llegamos a nuestro destino, salimos a cenar y escribimos una reseña en Trip Advisor. Los mismos inversores están en la base de cada aspecto de nuestro viaje. Y su poder va mucho más allá, porque incluso el queroseno que alimenta el avión proviene de alguna de sus muchas compañías petroleras y refinerías. Al igual que el acero del que está hecho el avión proviene de una de sus muchas compañías mineras.

Este pequeño club de sociedades de inversión, bancos y fondos mutuos, son también los mayores accionistas de las industrias primarias, de donde provienen nuestras materias primas”. Lo mismo ocurre con la industria agrícola de la que depende la industria alimentaria mundial y cualquier otra industria importante. Estos inversionistas institucionales son dueños de Bayer, el productor de semillas más grande del mundo; son dueños de los mayores fabricantes textiles y de muchas de las mayores empresas de ropa.

Son dueños de las refinerías de petróleo, son dueños de los mayores productores de paneles solares y las industrias de automóviles, aviones y armas. Son dueños de todas las principales compañías tabacaleras, y también de todas las principales compañías farmacéuticas e institutos científicos. También son dueños de los grandes almacenes y los mercados en línea como eBay, Amazon y AliExpress.

Incluso son dueños de los medios de pago que utilizamos hoy en día, desde compañías de tarjetas de crédito hasta plataformas de pago digital, además de compañías de seguros, bancos, constructoras, telefónicas, cadenas de restaurantes, marcas de cuidado personal y marcas de cosméticos.

Independientemente de la industria que mire, los principales accionistas y, por lo tanto, los que toman las decisiones, son los mismos: Vanguard, Blackrock, State StreetBerkshire Hathaway. En prácticamente todas las empresas importantes, encontrará estos nombres entre los 10 principales inversores institucionales.

¿Quién posee las empresas de inversión del mundo?

Profundizando más, encontramos que estas importantes empresas de inversión son, a su vez, propiedad de su propio conjunto de accionistas. Una de las cosas más sorprendentes de este esquema es que los inversores institucionales, y hay muchos más que los cuatro principales en los que nos hemos centrado aquí, también son dueños entre sí. Todos son accionistas de las empresas de los demás.

“Juntos, forman una inmensa red que podemos comparar con una pirámide”, dice Gielen. Los inversores institucionales más pequeños, como Citibank, ING y T. Rowe Price, son propiedad de empresas de inversión más grandes, como Northern Trust, Capital Group, 3G Capital y KKR.

Esos inversores, a su vez, son propiedad de firmas de inversión aún más grandes, como Goldman Sachs y Wellington Market, que son propiedad de firmas más grandes aún, como Berkshire Hathaway y State Street. En la parte superior de la pirámide, la muñeca rusa más grande de todas, encontramos a Vanguard y Blackrock.

“El poder de estas dos empresas es algo que apenas podemos imaginar”, dice Gielen. “No solo son los mayores inversores institucionales de todas las empresas importantes del mundo, sino que también son propietarios de los demás inversores institucionales de esas empresas, lo que les otorga un monopolio total”.

Gielen cita datos de Bloomberg, que muestran que para 2028, se espera que Vanguard y BlackRock administren colectivamente inversiones por valor de $ 20 billones. En el proceso, serán dueños de casi todo en el planeta Tierra.

Acciones en bolsa y participación en diversas empresas.

Acciones en bolsa y participación en diversas empresas.

Estas 10 empresas controlan la industria alimentaria global.

Estas 10 empresas controlan la industria alimentaria global.

BlackRock: la cuarta rama del gobierno

Bloomberg también se ha referido a BlackRock como la “cuarta rama del gobierno”, debido a su estrecha relación con los bancos centrales. BlackRock en realidad presta dinero al banco central, la reserva federal, y es su principal asesor.

Docenas de empleados de BlackRock han ocupado altos cargos en la Casa Blanca durante las administraciones de Bush, Obama y Biden. BlackRock también desarrolló el sistema informático que utilizan los bancos centrales.

¿Quién es el dueño de BlackRock?

Si bien Larry Fink es la figura decorativa de BlackRock, ya que es su fundador, presidente y director ejecutivo, no es el único que toma las decisiones, ya que BlackRock también es propiedad de los accionistas. Aquí encontramos otra curiosidad más, ya que el mayor accionista de BlackRock es Vanguard.

“Aquí es donde se oscurece”, dice Gielen. Vanguard tiene una estructura única que nos impide ver quiénes son los accionistas reales. “La élite propietaria de Vanguard no quiere que nadie sepa que son los dueños de la empresa más poderosa del mundo”. Aún así, si profundiza lo suficiente, puede encontrar pistas sobre quiénes son estos propietarios.

Se puede esperar que los propietarios de la compañía más rica y poderosa de la Tierra se encuentren entre las personas más ricas del planeta. En 2016, Oxfam informó que la riqueza combinada del 1% más rico del mundo era igual a la riqueza del 99% restante. En 2018, se informó que las personas más ricas del mundo obtuvieron el 82% de todo el dinero ganado en todo el mundo en el 2017.

En realidad, podemos suponer que los propietarios de Vanguard se encuentran entre el 0,001 % de las personas más ricas del planeta. Según Forbes, en marzo de 2020 había 2075 multimillonarios en el mundo. Gielen cita datos de Oxfam que muestran que dos tercios de los multimillonarios obtuvieron sus fortunas por herencia, monopolio o amiguismo.

“Esto significa que Vanguard está en manos de las familias más ricas del mundo”, dice Gielen. Entre ellos encontramos a los Rothschild, la familia DuPont, los Rockefeller, la familia Bush y la familia Morgan, solo por nombrar algunos.

Muchos pertenecen a linajes reales y son los fundadores de nuestro sistema bancario central, las Naciones Unidas y casi todas las industrias del planeta. Gielen va más allá en su documental, por lo que recomiendo verlo completo. Solo he resumido una pequeña parte de todo el documental aquí.

Un golpe de estado financiero

Hablando de los banqueros centrales, recientemente entrevisté a la gurú de las finanzas Catherine Austin Fitts, y ella cree que son los banqueros centrales los que están en el corazón de la adquisición global que estamos viendo actualmente. Ella también cree que son ellos los que presionan a las empresas privadas para que implementen los mandatos de vacunas COVID claramente ilegales. Su control es tan grande que pocas empresas tienen la capacidad de tomar una posición contra ellos.

“Creo que los banqueros centrales realmente dependen de la red inteligente y la tecnología espeluznante para ayudarlos a dar los últimos pasos del control financiero, que es lo que creo que están presionando.”, dijo.

“Lo que hemos visto es un tremendo esfuerzo por llevar a la bancarrota a la población ya los gobiernos para que sea mucho más fácil para los banqueros centrales tomar el control. Eso es lo que vengo escribiendo desde 1998, que esto es un golpe de Estado financiero.

Ahora se consolida el golpe de Estado financiero, donde los banqueros centrales sólo ejercen jurisdicción sobre el fisco y el dinero de los impuestos. Y si pueden obtener los pasaportes [de vacunas] con la CBDC [moneda digital del banco central], entonces podrá deducir impuestos de nuestras cuentas y tomar nuestros activos. Entonces, esto es un verdadero golpe de Estado”.

La carta de Espartaco

Una vez más, le insto a que vea el documental en la parte superior de este artículo y esté atento a mi entrevista con Austin Fitts, que se publicará en un futuro próximo. Para terminar, quiero resaltar una carta misteriosa publicada por un individuo anónimo que se hace llamar con el alias de “Spartacus”.

“COVID-19 — The Spartacus Letter” se publicó originalmente en docdroid.net, pero desde entonces se eliminó. Se puede encontrar otra copia en mega.nz. 1 The Automatic Earth 2 y Zero Hedge 3  que también han publicado la carta íntegramente. La carta comienza diciendo: "Mi nombre es Spartacus y ya tuve suficiente":

“Estamos viendo cómo el establecimiento médico inyecta literalmente veneno en millones de nuestros conciudadanos sin que ni siquiera peleemos. Nos han dicho que seremos despedidos y se nos negará nuestro sustento si nos negamos a vacunarnos. Esta fue la gota que colmó el vaso”.

Lo que sigue ahora es una compilación de datos que muestran que la pandemia del COVID fue un ataque de guerra biológica que se ha mantenido utilizando tácticas de guerra psicológica sofisticadas. También se repasa los peligros de las inyecciones de COVID, señalando que el virus y las “vacunas” fueron hechas por las mismas entidades.

Un resumen de los hallazgos de Spartacus es el siguiente. Cada punto del resumen se desarrolla en secciones posteriores de la carta, que puede leer en cualquiera de las tres referencias provistas.

• El COVID-19 es una enfermedad de la sangre y los vasos sanguíneos. El SARS-CoV-2 infecta el revestimiento de los vasos sanguíneos humanos y hace que se filtren a los pulmones.

• Los protocolos de tratamiento actuales (por ejemplo la ventilación invasiva) son activamente dañinos para los pacientes, ya que aceleran el estrés oxidativo y causan VILI (lesiones pulmonares inducidas por ventilador) graves. El uso continuado de ventiladores en ausencia de cualquier beneficio médico comprobado constituye un asesinato en masa.

• Las contramedidas existentes son inadecuadas para frenar la propagación de lo que es un virus en aerosol y potencialmente transmitido por aguas residuales, y constituyen una forma de teatro médico.

• Varios tratamientos y intervenciones no relacionados con las vacunas han sido suprimidos tanto por los medios de comunicación como por el establecimiento médico a favor de las vacunas y sus costosos medicamentos patentados.

• Las autoridades han negado la utilidad de la inmunidad natural contra el COVID-19, a pesar de que la inmunidad natural confiere protección contra todas las proteínas del virus, y no contra una sola.

• Las vacunas harán más daño que bien. El antígeno en el que se basan estas vacunas, SARS-CoV-2 Spike, es una proteína tóxica. El SARS-CoV-2 puede tener ADE o mejora dependiente de anticuerpos. Es posible que los anticuerpos actuales no neutralicen las cepas futuras, sino que realmente las ayuden a infectar las células inmunitarias. Además, vacunar durante una pandemia con una vacuna con fugas elimina la presión evolutiva para que un virus se vuelva menos letal.

• Existe una vasta y espantosa conspiración criminal que vincula directamente tanto a Anthony Fauci como a Moderna con el Instituto de Virología de Wuhan.

• Los investigadores de la vacuna COVID-19 están directamente vinculados a los científicos involucrados en la tecnología de interfaz cerebro-computadora ('encaje neuronal'), uno de los cuales fue acusado de recibir subvenciones de China.

• Investigadores independientes han descubierto misteriosas nanopartículas dentro de las vacunas que se supone que no deberían estar presentes.

• Toda la pandemia se está utilizando como excusa para una gran transformación política y económica de la sociedad occidental que enriquecerá a los que ya son ricos y nos convertirá al resto en siervos dalit o intocables.

Una conspiración criminal

Es una carta larga, así que no reproduciré todo aquí. Sin embargo, las siguientes secciones son de particular interés, con respecto a una élite criminal que está orquestando la destrucción de la vida tal como la conocemos, en un esfuerzo por marcar el comienzo de un sistema de gobierno y control global liderado por la tecnocracia: 4

“En noviembre de 2019, tres técnicos del Instituto de Virología de Wuhan desarrollaron síntomas consistentes con una enfermedad similar a la gripe. Anthony Fauci, Peter Daszak y Ralph Baric supieron de inmediato lo que había sucedido, porque existen canales secundarios entre este laboratorio y nuestros científicos y funcionarios.

El 12 de diciembre de 2019, Ralph Baric firmó un Acuerdo de transferencia de materiales (esencialmente, un NDA) para recibir materiales relacionados con la vacuna de ARNm contra el coronavirus, propiedad conjunta de Moderna y los NIH.

No fue sino hasta un mes después, el 11 de enero de 2020, que supuestamente China nos envió la secuencia de lo que se conocería como SARS-CoV-2. Moderna afirma, de manera bastante absurda, que desarrollaron una vacuna funcional a partir de esta secuencia en menos de 48 horas.

Stephane Bancel, el actual director ejecutivo de Moderna, fue anteriormente director ejecutivo de bioMerieux, una corporación multinacional francesa especializada en tecnología de diagnóstico médico, fundada por un tal Alain Merieux. Alain Merieux fue una de las personas que jugó un papel decisivo en la construcción del laboratorio P4 del Instituto de Virología de Wuhan.

La secuencia dada como el pariente más cercano al SARS-CoV-2, RaTG13, no es un virus real. Es una falsificación. Se hizo ingresando a mano una secuencia de genes en una base de datos, para crear una tapadera de la existencia del SARS-CoV-2, que es muy probable que sea una quimera de ganancia de función producida en el Instituto de Virología de Wuhan y es posible que luego se filtró por accidente o se liberó intencionalmente. Nunca se ha encontrado el reservorio animal del SARS-CoV-2.

Esta no es una 'teoría' de conspiración. Es una conspiración criminal real, en la que las personas conectadas con el desarrollo del ARNm-1273 de Moderna están directamente conectadas con el Instituto de Virología de Wuhan y su investigación de ganancia de función por muy pocos grados de separación, si es que hay alguno. El rastro de papel está bien establecido.

La teoría de la fuga de laboratorio ha sido suprimida porque tirar de ese hilo lleva a uno a concluir inevitablemente que hay suficiente evidencia circunstancial para vincular Moderna, el NIH, el WIV y la vacuna y la creación del virus.

En un país cuerdo, esto habría llevado de inmediato al caso RICO y el asesinato en masa más grande del mundo. Anthony Fauci, Peter Daszak, Ralph Baric, Shi Zhengli y Stephane Bancel, y sus cómplices, habrían sido acusados ​​y procesados ​​con todo el rigor de la ley. En cambio, miles de millones de dólares de nuestros impuestos fueron otorgados a estos mismos perpetradores.

El FBI allanó Allure Medical en Shelby Township, al norte de Detroit, por facturar a la empresa de seguros "curas fraudulentas de COVID-19". ¿El tratamiento que estaban usando?. Vitamina C intravenosa. Un antioxidante. Lo cual, como se describió anteriormente, es un tratamiento completamente válido para la sepsis inducida por COVID-19 y, de hecho, ahora es parte del protocolo MATH+ propuesto por el Dr. Paul E. Marik.

La FDA prohibió la ranitidina (Zantac) debido a una supuesta contaminación con NDMA (N-nitrosodimetilamina). La ranitidina no solo es un bloqueador H2 que se usa como antiácido, sino que también tiene un poderoso efecto antioxidante, eliminando los radicales hidroxilo. Esto le da utilidad en el tratamiento de COVID-19.

La FDA también intentó sacar de las estanterías a la N-acetilcisteína, un suplemento de aminoácidos inofensivo y antioxidante, lo que obligó a Amazon a eliminarlo de su tienda en línea. Esto nos deja con una pregunta escalofriante: ¿La FDA suprimió a sabiendas los antioxidantes útiles para tratar la sepsis por COVID-19 como parte de una conspiración criminal contra el público estadounidense?.

El establishment está cooperando y facilitando el trabajo a los peores criminales en la historia humana, y está suprimiendo activamente los tratamientos y terapias que no son vacunas para obligarnos a inyectar luego  los productos de estos criminales en nuestros cuerpos.

Conclusiones: La pandemia actual fue producida y perpetuada por el establishment, mediante el uso de un virus diseñado en un laboratorio de guerra biológica chino conectado al Ejército Popular de Liberación Chino (EPL), con la ayuda de los dólares de los contribuyentes estadounidenses y la experiencia francesa.

Ya sea a través de una filtración o una liberación intencional del Instituto de Virología de Wuhan, una cepa letal del SARS ahora es endémica en todo el mundo, después de que la OMS, los CDC y los funcionarios públicos primero minimizasen los riesgos y luego incitaran intencionalmente al pánico y a los bloqueos que pusieron en peligro la salud de las personas y sus medios de vida.

Esto fue luego utilizado por la clase aristocrática totalmente depravada y psicópata que nos gobierna como una excusa para obligar a las personas a aceptar un veneno inyectado que puede ser un agente de despoblación, un agente de control mental/pacificación en forma de "polvo inteligente" inyectable o ambas cosas…

Creen que pueden salirse con la suya utilizando como arma el estigma social del rechazo a la vacuna. Sus motivos son claros y obvios para cualquiera que haya estado prestando atención.

Estos megalómanos han asaltado los fondos de pensiones del mundo libre. Wall Street es insolvente y ha tenido una crisis de liquidez en curso desde finales de 2019. El objetivo ahora es ejercer un control total, físico, mental y financiero de espectro completo sobre la humanidad antes de que nos demos cuenta de lo mal que nos han extorsionado estos maníacos. La pandemia y su respuesta sirvieron para múltiples propósitos para la Élite, entre ellos:

• Ocultar una depresión económica provocada por el saqueo diario de nuestras economías realizado por capitalistas rentistas y propietarios ausentes que no producen absolutamente nada de valor alguno para la sociedad.

• Destruir pequeñas empresas y erosionar a la clase media.

• Transferir billones de dólares de riqueza del público estadounidense a los bolsillos de multimillonarios e intereses especiales.

• Participar en el uso de información privilegiada, comprar acciones en empresas de biotecnología y vender en corto negocios físicos y empresas de viajes, con el objetivo de colapsar el comercio y el turismo presenciales y reemplazarlos por el comercio electrónico y la servitización.

• Crear un casus belli para la guerra con China, animándonos a atacarlos, desperdiciando vidas y tesoros estadounidenses y llevándonos al borde del Armagedón nuclear.

• Establecer marcos tecnológicos y de bioseguridad para el control de la población y las 'ciudades inteligentes' tecnocrático-socialistas donde los movimientos de todas las personas se rastrean despóticamente, todo en anticipación de la automatización generalizada, el desempleo y la escasez de alimentos, utilizando el falso disfraz de una vacuna para obligar a una cooperación obligada y coercitiva.

Las élites están tratando de subir la escalera, borrar la movilidad ascendente de grandes segmentos de la población, sacrificar a los opositores políticos y otros 'indeseables', y poner al resto de la humanidad bajo control, racionando nuestro acceso a ciertos bienes y servicios, servicios que han considerado de 'alto impacto', como el uso del automóvil, el turismo, el consumo de carne, etc.

Naturalmente ellos seguirán teniendo sus propios lujos, como parte de un estricto sistema de castas similar al feudalismo. ¿Por qué están haciendo esto?. Es simple: estas élites son neomaltusianas y creen que el planeta Tierra está sobrepoblado y que el agotamiento de los recursos colapsará la civilización en cuestión de unas pocas décadas.

No están del todo necesariamente incorrectos en esta falsa creencia. Estamos superpoblados y consumimos demasiados recursos. Sin embargo, orquestar una toma de poder tan espantosa y asesina en respuesta a una crisis que se avecina demuestra que no tienen nada más que el mayor desprecio por sus semejantes.

Para aquellos que están participando en esta repugnante farsa sin entender lo que están haciendo, tenemos una palabra para ustedes; Deténgase. Está causando un daño irreparable a su país y a sus conciudadanos.

Para aquellos que puedan estar leyendo esta advertencia y tengan pleno conocimiento y comprensión de lo que están haciendo y cómo dañará injustamente a millones de personas inocentes, tenemos algunas palabras más: Maldita sea, al infierno. No destruirán América y el Mundo Libre, y no tendrán su Nuevo Orden Mundial. Nos aseguraremos de eso.

Fuentes y Referencias

1,4  Mega.nz La Carta de Espartaco

2  La Tierra Automática 26 de septiembre de 2021

3  Cobertura cero 27 de septiembre de 2021

Publicado con permiso de Mercola.com.

Ver comentarios

Dejen de dopar los datos económicos - Vlog de Marc Vidal

Publicado en por Skiper

Ver comentarios

Evidencia bioquímica y estadística oficial 100% confirma que Moderna creó el Covid-19

Publicado en por Skiper

Evidencia bioquímica y estadística oficial 100% confirma que Moderna creó el Covid-19

Fuente: https://expose-news.com/2022/07/04/proof-moderna-created-covid/

Traducción, corrección de la traducción y subrayado del texto relevante: Skiper

Ha surgido una evidencia que prueba más allá de toda duda razonable que el gigante farmacéutico Moderna, la compañía que ha ganado miles de millones con la venta de una inyección experimental de Covid-19, en realidad creó el virus Covid-19.

 

El 23 de febrero, el Daily Mail publicó un artículo que muestra que Moderna ha patentado la secuencia de 19 letras base (nucleótidos) que codifica el sitio Furin Cleavage en Covid-19. 

Por un lector preocupado

Citaron un artículo de científicos en la India, Suiza, Italia y los EE. UU. (cautelosamente titulado: MSH3 Homology and Potential Recombination Link to SARS-CoV-2 Furin Cleavage Site) en el que calcularon que las posibilidades de una secuencia de 19 nucleótidos patentada por Moderna que aparecen al azar en Covid-19 en circunstancias en las que no aparece en ningún otro lugar de la naturaleza son 1 entre 3 billones.

Pero fallaron en hacer la deducción obvia de ahí. Si hubieran hecho dicha deducción obvia, ¡me temo que podría haber sido la última deducción científica que publicaron!. Decidieron investigar la secuencia de ARN para el sitio de escisión de Furin en la proteína Spike de Covid-19 para ver si ocurría en algún otro lugar de la naturaleza.

Afortunadamente, el NCBI/NIH ha producido la maravillosa base de datos BLAST que cataloga todas las secuencias de genes en la naturaleza conocidas por el hombre y todas las secuencias de genes sintéticas patentadas conocidas por la oficina de patentes.

Los investigadores eligieron la secuencia Furin Cleavage porque es la única secuencia continua de letras genéticas (secuencia de nucleótidos) en el Covid-19 con más de 3 nucleótidos, que difiere de las letras respectivas en su pariente natural más cercano, el coronavirus de murciélago RaTG13 (todas las demás diferencias son 3 letras o menos de largo). Por lo tanto, fue, con mucho, el mejor candidato para determinar si el covid-19 fue creado por el hombre o no.

El lector podría considerar que es más probable que aparezca un sitio de escisión de Furin en el Sun que en el Daily Mail. Pero esta escisión se refiere a la separación de la espiga del virus en lugar de la separación de la almohada. 

Además, el sitio de escisión de Furin es clave para la patogenicidad de Covid-19Entonces, si hubiera alguna ganancia de función hecha por el hombre incluida en el virus, aquí es donde uno podría esperar encontrarla.

La secuencia de aminoácidos del sitio de escisión de furina es PRRA (prolina argenina argenina alanina). Cada aminoácido está codificado por un codón, que consta de 3 nucleótidos (letras de secuencia genética). Entonces, todas las diferencias en el código genético entre Covid-19 y RaTG13 tienen como máximo un codón de largo, un aminoácido de largo, aparte de la secuencia de escisión de Furin, que es...

CCT CGG CGG GCA

La secuencia complementaria (la hebra de ADN opuesta de la doble hélice es (GGAGCCGCCCGT) porque C se une con G y A se une con T

El cumplido inverso (lo mismo escrito al revés) es por lo tanto TGCCCGCCGAGG

Los investigadores realizaron una búsqueda de alineación BLAST (Herramienta básica de búsqueda de alineación local) (lo que significa que buscan la secuencia del gen, la secuencia del gen inversa, la secuencia del gen complementaria y la secuencia del gen complementaria inversa) a través de cada secuencia de genes en la naturaleza conocida por el hombre para CTCCTCGGCGGGCACGTAG que es la secuencia de 19 nucleótidos que contiene la Furin Cleavage Sequence, que también aparece en Covid-19, y que se encuentra en realidad en la forma de complemento inverso CTACTGTGCCCGCCGAGGAG patentada por Moderna. Sus resultados de búsqueda se pueden encontrar aquí. 

La Tabla 1 muestra que sí existe en las 5 patentes estadounidenses citadas a continuación...

US9149506B2: Polinucleótidos modificados que codifican septin-4 –https://patents.google.com/patent/US9149506B2/en

Patente 1

Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Asignado actual: ModernaTx Inc 
2012-04-02 Prioridad a US201261618953P
2013-12-16 Solicitud presentada por Moderna Therapeutics Inc
2014-05-22 Publicación de US20140141067A1
2015-10-06 Publicación de US9149506B2
2015-10-06 Solicitud concedida
2020-01-10 Primer litigio familiar mundial presentado

US9216205B2: Polinucleótidos modificados que codifican granulisina – https:// patents.google.com/patent/US9216205B2/en

Patente 2

Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Asignado actual: ModernaTx Inc 
2012-04-02 Prioridad a US201261618873P
2013-12-16 Solicitud presentada por Moderna Therapeutics Inc
2014-04-24 Publicación de US20140113960A1
2015-12-22 Publicación de US9216205B2 2015-12-22
Solicitud concedida
proteína ligasa 1 –
 https://patents.google.com/patent/US9255129B2/en

Patente 3

Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Asignado actual: ModernaTx Inc 
2012-04-02 Prioridad a US201261618868P
2013-12-16 Solicitud presentada por Moderna Therapeutics Inc
2014-05-22 Publicación de US20140141068A1
2016-02-09 Solicitud concedida
2016-02-09 Publicación de US9255129B2
US9301993B2: polinucleótidos modificados que codifican el factor inductor de apoptosis 1:
 https://patents.google.com/patent/US9301993B2/en

Patente 4

Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Asignado actual: ModernaTx Inc 
2012-04-02 Prioridad para US201261618957P
2013-12- 16 Solicitud presentada por Moderna Therapeutics Inc
2014-04-17 Publicación de US20140107189A1
2016-04-05 Solicitud concedida
2016-04-05 Publicación de US9301993B2
2020-01-10 Primer litigio familiar mundial presentado

US9587003B2: polinucleótidos modificados para la producción de proteínas y péptidos relacionados con la oncología: https://patents.google.com/patent/US9587003B2/en
 

Patente 5

Inventor: Stephane Bancel, Tirtha Chakraborty, Antonin de Fougerolles, Sayda M. Elbashir, Matthias John, Atanu Roy, Susan Whoriskey, Kristy M. Wood, Paul Hatala, Jason P. Schrum, Kenechi Ejebe, Jeff Lynn Ellsworth, Justin Guild
Asignado actual: ModernaTx Inc 
2012-04-02 Prioridad a US201261618868P
2016-02-04 Solicitud presentada por ModernaTx Inc
2016-06-02 Publicación de US20160152678A1
2017-03-07 Publicación de US9587003B2
2017-03-07 Solicitud concedida

Así que Moderna solicitó por primera vez una patente para la secuencia de 19 nucleótidos en el 2013, el 16 de diciembre. Quizás el 25 de diciembre hubiera sido más apropiado ya que estaba destinado a convertirse en la corona de espinas de Maías27, Marcos15 y Juan19.

La tabla 2: muestra que la secuencia ocurre en Covid-19 desde el nucleótido 23601 hasta el 23619.

La tabla 3: muestra que esta secuencia de genes no existe en la naturaleza (pero 14 partes de nucleótidos sí). 

Decidí comprobar su trabajo. Sí. Los verifiqué de hecho (enviaré una factura a los globalistas). Esto resultó ser un poco un viaje épico. La página de patentes de Google para US9587003B2 no contiene la secuencia del gen. El pdf de la patente no contiene la secuencia del gen y no se puede buscar desde las páginas 101-304. Pero tiene un enlace a una extensa sección de 'Lista de secuencias' cuyo enlace no se puede copiar. Así que lo transcribí manualmente con mi mano limpia: http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US09587003B2 

Desde esa página, puede ingresar la ID de secuencia citada en el documento como 11652 y acceder a https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09587003B2&seqID=11652 que tiene lo siguiente en Nucleotides 2751-2733 leyendo al revés...

gccctgatca ccatcatggc ccagatcggc agctacgtgc ccgccgagga ggccaccatc 2760

CTACGTGCCCGCCGAGGAG patentado por Moderna es el complemento inverso de CTCCTCGGCGGGCACGTAG, la secuencia de 19 nucleótidos que aparece en el ADN de Covid-19 desde el nucleótido 23601-23619 (que, por lo tanto, estaría cubierto por su patente).

Del mismo modo, puede buscar la secuencia en US9149506B2 yendo a https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09149506B2&seqID=11652, con lo cual volverá a encontrar lo mismo

gccctgatca ccatcatggc ccagatcggc agctacgtgc ccgccgagga ggccaccatc 2760

Luego busqué la secuencia del gen de Wuhan Hu1 (alfa) en https://www.ncbi.nlm.nih.gov/nucore/NC_045512 y encontré:

23581 ttatcagact cagactaatt ctcctcggcg ggcacgtagt gtagctagtc aatccatcat de
https://www.ncbi.nlm.nih.gov/nuccore/NC_045512
Evidencia bioquímica y estadística oficial 100% confirma que Moderna creó el Covid-19

Que tiene la secuencia de 19 nucleótidos CTCCTCGGCGGGCACGTAG de 23601-23619 como se describe en la tabla 3. Luego ejecuté mi propia búsqueda explosiva no alineada de todas las secuencias genéticas patentadas para el complemento inverso directamente (o quizás para un complemento inverso) y obtuve los mismos resultados que los investigadores. Y lo mismo para las otras 3 patentes estadounidenses.

Así que puedo confirmar, y el lector puede confirmar usando los enlaces anteriores, que Moderna solicitó una patente no solo sobre el complemento inverso del sitio de escisión de furina de 12 nucleótidos en Covid-19, sino también sobre la secuencia de 19 nucleótidos que lo contiene como se describe arriba.

Además, no solo solicitaron una patente el 4 de febrero de 2016 con US9587003B2: como se informó en el Daily Mail. De hecho, solicitaron el 16 de diciembre del 2013 cuatro patentes con números: US9149506B2, US9216205B2, US9255129B2, US9301993B2

Así que Moderna había desarrollado la secuencia del gen de 19 nucleótidos que contiene el sitio de escisión de Furin que le da al Covid19 su infectividad para los humanos mediante una investigación patentada de ganancia de función ya en 2013, 6 años antes de que ocurriera el brote de WuhanNo tres años como se informó en el Daily Mail y luego viralmente en otros lugares.

Así que ahora analizamos las posibilidades de que esto ocurra de forma natural. El documento calcula la probabilidad de que esta secuencia particular de 19 nucleótidos ocurra al azar en un virus de 30,000 nucleótidos como:

(30.000-18) x (1/4)19 = 1,09 x 10-7

Lo cual es correcto porque hay entre 30.000 y 18 lugares para comenzar la secuencia dado que necesita otras 18 letras más para completarla. Pero en realidad hay 29.904 nucleótidos en Wuhan HU1 (alfa). Así que un cálculo más preciso sería:

(29,904-18) x (1/4)19 = 1.087 x 10-7

Luego calculan las posibilidades de que la secuencia de 19 nucleótidos aparezca en la biblioteca patentada de 24.712 secuencias con una longitud media de 3300 nucleótidos. Pero ese cálculo es irrelevante porque la secuencia no apareció aleatoriamente en las solicitudes de las cinco Patentes de Moderna. Se sabía que la secuencia codificaba un sitio de escisión de Furin, que se sabe que proporciona una ganancia de función a los coronavirus.

Eso fue puesto allí deliberadamente y patentado debido a su poder infectante en humanos, que veremos, más adelante en el artículo, resulta del codón AGA de Arginina (R) viral normal (usado en el 45% de los codones de Arginina viral) siendo reemplazado por el codón de arginina humana CGG (utilizado en el 0% de los codones de arginina viral) en el sitio de escisión de furina.

Todo lo que estamos tratando de resolver aquí es cuáles son las posibilidades de que una secuencia de 19 nucleótidos patentada por Moderna aparezca en el Covid-19 por causas naturales, las mutaciones naturales del Bat Coronavirus RaTG13 o en algún otro virus.

Los nucleótidos forman codones que son tripletes. Entonces hay 64 tripletes posibles de los 4 nucleótidos de ADN ACGT (4x4x4 = 64). Pero todos los trillizos ocurren. 61 codifican 20 aminoácidos de forma redundante y 3 son codones de terminación que le indican al ribosoma que deje de producir la proteína.

Pero las cosas no son tan simples porque el sitio de escisión de Furin aparece en la proteína de punta donde debe estar y la proteína de punta solo tiene 1273 × 3 = 3819 nucleótidos. Las posibilidades de que la secuencia de escisión de furina de 19 nucleótidos aparezca en la proteína espiga son 

(3,819-18) x (1/4)19 = 1.389 x 10-8

O dicho de otra forma: 1 entre 72 millones. Esas serían las posibilidades de que una variante en particular, digamos la primera variante de Covid-19, tuviera la secuencia de 19 nucleótidos en el lugar correcto (el pico). Y lo hizo. Entonces, ciertamente por el equilibrio de probabilidades, y ciertamente más allá de una duda razonable (1 en 72 millones es una duda irrazonable) se puede decir que Moderna fabricó el Covid-19. 

Prueba 100% bioquímica de que el Covid19 fue hecho por el hombre

El doble codón CGG utilizado en el sitio de escisión de furina específico de Moderna no se encuentra en ningún otro sitio de escisión de furina en ningún otro virus de la naturalezaLos sitios de escisión de furina ocurren en otros virus, pero NO en otros betacoronavirus como el Covid-19 y NO en absoluto con el doble codón CGG.

La arginina (R), puede ser codificada por cualquiera de los 6 tripletes: AGG, AGA, CGA, CGC, CGG, CGT. En Covid-19, el sitio de furina (PRRA), tiene 12 nucleótidos (3 x 4). En Covid-19, el doblete RR del sitio de furina está codificado por CGG-CGG.  

Dos bioquímicos, el profesor Antonio R. Romeu y el profesor adjunto Enric Ollé, analizaron el doblete RR de una gran muestra de sitios de escisión de furina de varios tipos de virusDescubrieron que no había dobletes RR codificados por los codones CGG-CGG en ningún virus de la naturaleza. Observaron que el triplete AGA era el codón mayoritario involucrado en estos dobletes RR virales.

En toda recombinación genética (donde una parte de un genoma se fusiona con otro genoma), el código del donante se pasa al receptor. Pero simplemente NO HAY VIRUS CONOCIDO con un sitio de escisión de furina específico de Moderna (que tiene el par de codones CGG-CGG) que exista para donar un sitio de escisión de furina específico de Moderna a Covid19. Entonces, la única forma en que esa secuencia podría ingresar en el Covid-19 es de Moderna. Moderna fue el donante. La naturaleza no lo era. Quod erat demonstrandum (QED). Caso cerrado. 

Pero se pone peor. Los profesores españoles decidieron analizar el uso del codón de arginina en cada proteína en Covid-19. El encontró lo siguiente…
AGG (13%)
AGA (45%)
CGA (5%)
CGC (10%)
CGG (3%)
CGT (24%). 

Entonces, el triplete de codones AGA era el mayoritario y, curiosamente, CGG era el codón minoritario para la arginina en el virus. 

Pero se pone peor aún.

En el caso específico de la proteína S, de las 42 Argininas (R) que posee, 20 están codificadas por AGA, y solo 2 por CGG. Estos dos, por supuesto, son los dos presentes en el sitio de escisión de Furin específico de Moderna.

Entonces, la única arginina en la proteína de pico que está codificada en Moderna está en el sitio de escisión de furina. Las otras 40 instancias no usan CGG en absoluto. Luego continúan comentando que cada especie individual en la naturaleza tiene sus propias preferencias de codones. Obviamente, a los virus presentes en la naturaleza les gusta AGA, y no les gusta CGG en absoluto.

Pero adivinen qué especie usa CGG para la arginina más que los otros 5 codones de la competencia: sí, la especie es el viejo homo sapiens. Nuestras preferencias de codificación para la arginina son:

AGG (20%)
AGA (20%)
CGA (11%)
CGC (19%)
CGG (21%)
CGT (9%).

Entonces, el codón CGG en el sitio de escisión de furina se habrá producido a través de la investigación de ganancia de función quimérica (combinación de animales humanos)

¿Podría alguien que no sea Moderna haber creado el Covid-19 utilizando el sitio de escisión de furina específico de Moderna?

“Nuevos documentos muestran que solo 18 meses antes de que aparecieran los primeros casos de Covid-19, los investigadores habían presentado planes para liberar nanopartículas que penetran en la piel y aerosoles que contienen “nuevas proteínas de punta quimérica” de coronavirus de murciélago en murciélagos de cueva en Yunnan, China. También planearon crear virus quiméricos, mejorados genéticamente para infectar a los humanos con mayor facilidad, y solicitaron 14 millones de dólares a la Agencia de Proyectos de Investigación Avanzada de Defensa (Darpa) para financiar el trabajo.

Los documentos, confirmados como genuinos por un ex miembro de la administración Trump, muestran que esperaban introducir "sitios de división específicos para humanos" para los coronavirus de murciélago, lo que facilitaría que el virus ingrese a las células humanas. 
Cuando el covid-19 se secuenció genéticamente por primera vez, los científicos estaban desconcertados acerca de cómo el virus había desarrollado una adaptación tan específica para los humanos en el sitio de escisión de la proteína espiga, que es la razón por la que es tan infeccioso”. 
 the Telegraph

Puedo ver a todos los grandes periodistas en el Daily Mail y el Telegraph (sin mencionar a los científicos de todo el mundo) haciendo toda esta investigación sobre el Covid19 y llegando a la inevitable conclusión lógica de que hubo una fuga accidental o deliberada en un laboratorio y luego teniendo que redactar sus conclusiones de tal manera que etiqueten esa fuerte probabilidad solo como una posibilidad débil. 

Pero aquí arriba lo hemos demostrado como un hecho (dado que el codón CGG de la secuencia de escisión de furina específica de Moderna no se encuentra en ningún sitio de escisión de furina en ningún virus natural y, por lo tanto, no puede haber sido el resultado de una recombinación genética natural. Por lo tanto, tiene que ser el resultado de una inserción genética hecha por el hombre. 

En teoría, otra parte involucrada con la NAIAD o los NIH podría haber utilizado el sitio de escisión de furina patentado por Moderna y luego crear el Covid19 ellos mismos. Esto no habría violado ninguna patente de Moderna. El sitio de escisión de Furin en sí mismo no es patentable y se conoce desde al menos el año 2004.

US7223390B2: Inserción de sitios de escisión de furina proteasa en proteínas de membrana y usos de los mismos 
2004-05-07 Solicitud presentada por Research Development Foundation
2004-11-11 Publicación de US20040224391A1
2007-05-29 Solicitud concedida

Aunque Moderna en realidad podría haber patentado la codificación Moderna Specific (CGG para AGA) del sitio de escisión de furina, que no se conoce en la naturaleza incluso hoy, si aceptamos que Covid-19 está hecho por el hombre.

Pero dado que la fuga de laboratorio (deliberada o accidental) proviniese de Wuhan, y dado que los chinos lo encubrieron y dado que Fauci desmintió y fue expuesto por el senador Rand Paul, y dado que los NIH, los encubrimientos del NIAID y los servicios de inteligencia de EE.UU. encubrieron todo el asunto, cuando su  informe de 3 meses sobre el origen de Covid-19 ordenado por el imitador presidencial Biden no arrojó nada, y dadas las relaciones entre el NIAID, el NIH, el WIV, EcoHealth Alliance, la Universidad de Carolina del Norte y Moderna, no puedo ver ninguna habitación. para cualquier otra persona.

Además, toda la camarilla profana de malos actores comenzó a desarrollar Moderna Vaccine antes de que ocurriera la pandemia: https://www.infowars.com/posts/must-watch-nih-claimed-joint-ownership-of-moderna-mrna-vaccine- comenzó-desarrollo-semanas-antes-de-la-pandemia/ 

Pero las cosas no son tan simples porque la naturaleza ciertamente ha tenido 100.000 años para crear virus humanos y nunca colocó un sitio de escisión de furina específico de Moderna (CGG para AGA) en nada, ni colocó la secuencia de 19 nucleótidos en nada antes.

Sin embargo, dentro de los seis años posteriores en los que Moderna lo patentó, lo encontramos en el Covid-19 y en circunstancias en las que Moderna está trabajando con ese virus. Así que ahí la probabilidad no es de 100.000 a 6 o 16.666 a 1 de que Moderna sea responsable en lugar de la naturaleza. No, la posibilidad es de un 100% porque la naturaleza no lo ha hecho. Nunca lo ha hecho y no hay evidencia de que alguna vez lo hará. Es el hombre el que mezcla codones de arginina humanos y virales, no la naturaleza. 

El profesional Luc Montagnier pasó los últimos años de su vida demostrando que el COVID-19 fue creado por el hombre y que contenía gran parte del código genético del VIH1.

El profesor Luc Montagnier, antes de morir el 8 de febrero de 2022, hizo un asesinato total del concepto de que el Covid-19 evolucionó naturalmente al demostrar que tenía una equivalencia masiva con el VIHEl siguiente diagrama muestra una región de 275 nucleótidos de Covid-19 que tiene 200 nucleótidos de HIV/SIV (Simian ImmunoVirus) en ella. Y recuerde que hay 61 codones que especifican 20 aminoácidos. Entonces, uno puede decir lo mismo en un promedio de 3 formas diferentes con codones.

Evidencia bioquímica y estadística oficial 100% confirma que Moderna creó el Covid-19

Puede descargar un pdf de su estudio aquí* y los materiales complementarios aquí*Es muy técnico. Pero ganó el premio Nobel por descubrir el virus del VIH. Entonces, si alguien supiera si el Covid se había potenciado con el VIH, sería él. El señaló que el Covid-19 fue hecho por el hombre al principio de la pandemia y, como resultado, él mismo fue asesinado por la prensa y los verificadores de hechos. Todos los verificadores de hechos que lo atacaron estaban equivocados.

(*: Parece que alguien eliminó deliberadamente los dos pdf adjuntos del artículo original.)

No había ninguna base científica para ninguna de sus verificaciones de hechos. Estos conjuntos no son verificadores de datos en absoluto, por supuesto. Son agencias de desinformación globalistas, hijos de Goebbels, chismosos y negadores de la ciencia. Son tan confiables como una elección estadounidense.

Puedo comprobar un hecho por mí mismo, muchas gracias. No necesito que un estudiante de madraza despierto con lavado de cerebro me diga su opinión sobre un tema que nunca estudió en la universidad.

Dado que hemos demostrado más allá de una duda razonable (más allá de una duda de 1 en 72 millones estáticamente y con un 100% de certeza bioquímicamente del sitio de escisión de furina específico de Moderna) que Moderna hizo el Covid-19 y dado que Moderna y Fauci no han admitido haberlo hecho y, de hecho, han ocultado pruebas en ese sentido, es posible que también estén ocultando algo más.

Porque las dos únicas teorías que quedan ahora son la teoría de la fuga accidental en el laboratorio y la teoría de la fuga deliberada en el laboratorio. Quiero decir que la gran mayoría de las filtraciones políticas no son accidentes. Son estrategias deliberadas para dar ventaja al filtrador o a su pagador. Es bien sabido en la industria de la Tecnología de la Información que los virus aparecen justo cuando se necesitan ventas de antivirus. ¿Por qué las cosas serían diferentes con los virus humanos ahora que también pueden ser creados por el hombre?. Especialmente cuando considera el papel masivo de Bill Gates y su fundación y GAVI y GVAP en el negocio global de vacunación.

La única razón por la que Moderna fabricaría el Covid-19 es para lanzarlo. De lo contrario, todo el ejercicio sería financieramente inútil y comercialmente sin sentido. La razón aducida por Fauci para hacer investigación de ganancia de función es que el hombre necesita estar por delante de la naturaleza o de los malos actores para tener una vacuna a tiempo si una enfermedad muta o es modificada genéticamente por los chinos o los rusos para que sea letal.

Pero para creer eso, uno tiene que creer que Moderna está interesada en salvar la vida de las personas. Lo siento. Todas sus acciones muestran que Moderna está interesada ​​​​en vacunar a las personas sabiendo aún  cuán probable es que eso será lo que les cueste la vida. 

Les interesa la ganancia, la ganancia que proviene de una pandemia. No son salvadores de la humanidad como ellos representan. Son nuestros explotadores y nuestros abusadores.

Produjeron el virus para filtrarlo, para hacerse pasar por nuestros salvadores de su propia fuga. Estas no son las actividades de una figura salvadora. Luc Montagnier estaba tratando de ser nuestro salvador de ellos y fue asesinado (profesionalmente) por sus groupies.

Moderna estaba haciendo una investigación de ganancia de función para liberar el virus y forzar una vacuna para él de una manera que maximizaría sus ganancias. Esa no es una teoría de la conspiración. Es lo que pasó precisamente. El precio de sus acciones subió 20 vecesLo lanzaron para vender sus vacunas y destruir el sistema inmunológico de sus clientes porque nuestro sistema inmunológico reduce sus ganancias. Ese es el negocio de las grandes farmacéuticas. 

La razón por la que el escritor confía tanto en que Moderna o sus agentes crearon y filtraron el Covid-19 y la razón por la que lo llamé así al comienzo de la pandemia para casi tanto ridículo como recibió el profesor Montagnier (Dios lo bendiga) es que el las escrituras dicen en Mateo 27, Marcos 15 y Juan 19 que: 

29 Y ellos (los soldados del gobernador del versículo 27) trenzaron una corona de espinas y la pusieron sobre su cabeza, y una caña en su mano derecha; y se arrodillaron delante de él, y se burlaban de él, diciendo: ¡Salve, rey de los judíos!
30 Y le escupieron, y tomando la caña, le golpearon en la cabeza. (Mateo 27 NVI)

Permítame, pues, suplicar su indulgencia mientras interpreto estas palabras: 

El departamento de defensa de EE.UU. financió el empalme de genes del coronavirus de proteínas Spike (Covid-19) a través de NIH, NIAID y DARPA, que primero infectó a Jesús, a través de su prometido, los Santos del Nuevo Pacto, justo después de que se convirtió en el Rey secular, César para esos santos, los judíos antitípicos, aquellos pactados para ser hijos angelicales de Jacob, los nacidos de nuevo angelicalmente.

Calculamos que la maldición que impidió que Jesús se convirtiera en César para los santos terminó en 2019 Tishri 15 (17/18 de octubre). Glenn Beck hizo un documental que muestra que 10 hospitales en Wuhan tomaron casos con síntomas de Covid19 en octubre de 2019. Sí, amigos. El Covid-19 es una prueba de que Jesús ahora es Rey secular sobre los santos, los judíos antitípicos, los judíos por pacto de salvación angelical, por lo menos.

Pero entonces los soldados le escupieron. Porque así es como se transmite el Covid19, a través de pequeñas gotas de aerosol que se exhalan por la boca. Los soldados le escupieron deliberadamente. ¡No fue una FUGA DE SALIVA!. Golpearon a Jesús en la cabeza porque los santos son la cabeza de la iglesia y contrajeron el Covid19 no por una infección aleatoria, sino por un golpe deliberado con un arma biológica, un ataque armado deliberado. Para obtener más información sobre esto, consulte aquí*.

Entonces, lo que vio el profesor Montagnier con su experiencia en virología, lo vi con mi experiencia teológica. Demostrando que, si bien los verificadores de hechos y la ciencia son mutuamente excluyentes, la ciencia y la teología en realidad están de acuerdo, cuando se entienden correctamente (y esa es una gran advertencia). El Profesor Montagnier nos enseñó que las vacunas causan las variantes. De hecho, la virología básica prohíbe la vacunación masiva durante una pandemia por esa misma razón. El dijo que la curva de muertes sigue la curva de vacunas. Eso sí, paradójicamente, si las vacunas causaron Omicron, ¡entonces nos salvaron de sí mismas!.

Ha llegado el momento de hacer que las personas y las organizaciones rindan cuentas

Los fabricantes del Covid19, los fabricantes de vacunas genéticas, sus financiadores y sus promotores, que incluyen a casi todos los gobiernos y sectores públicos y servicios de salud del mundo, son por lo tanto culpables de genocidio y crímenes de lesa humanidad. Han llevado la violación genética, la enfermedad y la muerte a la mitad de la población del mundo para enriquecer los bolsillos de las compañías farmacéuticas. Los gobiernos y los sectores públicos de todo el mundo han abandonado la regulación de sus servicios de salud en manos de multimillonarios y corporaciones sin corazón.

En el Reino Unido, todo el impuesto sobre la renta que pagamos va al servicio de salud y todos sus protocolos están determinados por sus reguladores y todos sus reguladores están controlados y financiados por la Big Pharma que busca dañar y luego administrar nuestra salud para su beneficio. Así que cada centavo que gastamos en impuestos sobre la renta nos acerca un paso más a la enfermedad, a la muerte y a la drogodependencia.

Entonces, ¿por qué el profesor Montagnier decidió pasar los últimos años de su vida demostrando que el Covid-19 fue creado por el hombre y que las proteínas de pico y, por lo tanto, las vacunas, eran una amenaza existencial para la especie? ¿Qué le quedaba por probarse a sí mismo o a los demás en el 87-89?. Ciertamente no lo hizo para aumentar su reputación en la profesión.

No, lo que le impulsaba es la misma pasión que lo llevó a descubrir el VIH. Una pasión por SALVAR a la humanidad de los virus y de aquellos que los diseñarían para dañarnos. ¿Y por qué entregó el fantasma en febrero de 2022?. Porque sabía que Omicron tenía las vacunas vencidas. Su trabajo fue hecho por un virólogo más grande incluso que él. Por lo tanto, pudo descansar en paz e ir a ver a algunas personas que entendieron la magnitud de su contribución.

El Covid-19 no se hizo en el 2019. Se hizo a partir del sitio de escisión de furina quimérico específico de Moderna (CGG para AGA) de 19 nucleótidos que no se encuentra en ninguna parte de la naturaleza.
Y cada muerte por el Covid y cada muerte por las vacunas de Covid están aparcadas directamente en la puerta de ModeRNA esperando justicia.

Pero no ejecutaremos esa justicia lo suficientemente rápido. Y por lo tanto, la plaga final sobre la humanidad citada en Apocalipsis 6:8, entregada por el cuarto jinete del apocalipsis, plaga que el mismo Bill Gates ha profetizado, llegará más tarde este año (después de la Guerra y después del Hambre, el segundo y el tercer jinete).

Ver comentarios

Descubre que esconde la nueva portada de la revista The Economist para julio de 2022

Publicado en por Skiper

Ver comentarios

SOTT Radio Network N.º 382, 2 de julio, 2022 - La OTAN: la soga en el cuello de Europa

Publicado en por Skiper

Ver comentarios

Estudio revisado por pares: La vacuna Moderna aumenta 44 veces el riesgo de miocarditis en adultos jóvenes

Publicado en por Skiper

Estudio revisado por pares: La vacuna Moderna aumenta 44 veces el riesgo de miocarditis en adultos jóvenes

Fuente: https://www.theepochtimes.com/moderna-vaccine-increases-myocarditis-risk-by-44-times-in-young-adults-peer-reviewed-study_4561018.html

Traducción, corrección de la traducción y subrayado del texto relevante: Skiper

Un estudio francés revisado por pares concluyó que tanto para las vacunas de Pfizer como las de Moderna, el riesgo de miocarditis se dispara una semana después de la vacunación.

El riesgo de miocarditis después de la vacunación con ARNm fue 8 veces y 30 veces mayor que los grupos de control no vacunados para BNT162b2 (Pfizer-BioNTech) y ARNm-1273 (Moderna), respectivamente. La mayor asociación de miocarditis después de la inyección de Moderna fue un riesgo 44 veces mayor para las personas de 18 a 24 años.

En cuanto a la inyección de Pfizer, en relación al mismo grupo de edad, el riesgo fue 13 veces mayor. La infección con el virus del Partido Comunista Chino produjo, en comparación, un riesgo 9 veces mayor de padecer la misma afección.

La miocarditis se refiere a la inflamación del músculo cardíaco, una afección potencialmente mortal. Hay muchas causas establecidas para esta afección cardíacaLa causa principal, según los descubrimientos más recientes de la ciencia moderna, son los virus; pero durante la pandemia, las vacunas de ARNm de la COVID se han ganado un lugar entre las principales sospechosas de miocarditis.

El objetivo del nuevo estudio era proporcionar una evaluación de la asociación con las vacunas entre sexos y grupos de edad. “Tanto la infección por SARS-CoV2 como las vacunas de ARNm de COVID se han asociado con la miocarditis. Conociendo la afinidad de la proteína espiga con los receptores ACE2 en el corazón y la lesión de la proteína espiga en los cardiomiocitos (células del corazón), la asociación de la miocarditis con el virus SARS-CoV2 o la vacunación con ARNm basada en la proteína espiga no fue del todo inesperada”, dijo el Dr. Sanjay Verma, un cardiólogo a The Epoch Times por correo electrónico.

Verma también cree que el análisis de los CDC "sugiere erróneamente" que el riesgo de miocarditis después de la infección por SARS-CoV2 es mayor que después de la vacunación con ARNm de COVID-19. “Para los casos de miocarditis después del SARS-CoV2, los CDC usan 'casos' de PCR+ confirmados oficialmente, aunque sus propios datos de seroprevalencia demuestran que se han infectado muchas más personas que los 'casos' de PCR+ confirmados oficialmentePor ejemplo, los datos de seroprevalencia al 21 de febrero de 2022 revelan que el 75 % (alrededor de 54 millones) de todos los niños han sido infectados en comparación con los 12 millones de 'casos' de PCR+ confirmados oficialmente; es decir, el número real de niños infectados es 4,5 veces mayor que PCR+ 'casos'. 

Por lo tanto, al calcular el riesgo de miocarditis después de la infección por SARS-CoV2, la tasa señalada por los CDC debería reducirse 4,5 veces. Hasta el momento, los CDC no han ajustado sus datos de morbilidad y mortalidad de COVID-19 en consecuencia”, dijo el cardiólogo, que ejerce en Coachella Valley, California.

El estudio analizó 1612 casos de miocarditis y 1613 casos de pericarditis en Francia desde el 12 de mayo de 2021 hasta el 31 de octubre de 2021, involucrando a 32 millones de personas de 12 a 50 años que recibieron 46 millones de dosis de vacunas de ARNm. El estudio se limita al utilizar únicamente diagnósticos de alta hospitalaria. Por lo tanto, no incluye a aquellos que pueden haber muerto antes de ser hospitalizados o aquellos cuyos síntomas no fueron lo suficientemente graves como para ser hospitalizados.

“Ha habido informes (pdf) de miocarditis comprobada por autopsia después de la vacunación y evidencia anecdótica de pacientes que fueron dados de alta por la sala de emergencias y nunca fueron hospitalizados. El ajuste de estos subconjuntos excluidos puede generar un riesgo aún mayor que el informado en este estudio

El seguimiento de los pacientes de este estudio se limitó a un mes después del altaSin embargo, un estudio previo de resonancia magnética cardíaca encontró que alrededor del 75 por ciento de los pacientes con miocarditis asociada a la vacuna, pueden tener anomalías persistentes en la resonancia magnética de 3 a 8 meses después del diagnóstico inicial”, dijo Verma. Los autores del estudio no analizaron el efecto de la vacunación de refuerzo, ya que aún no se recomienda para adultos jóvenes en Francia.

En los Estados Unidos, sin embargo, las inyecciones de refuerzo son obligatorias por colegios y universidades, empleadores e incluso algunos departamentos de salud pública estatales, independientemente de la edad o la infección previa.

“En una preimpresión de seguimiento de su estudio revisado por pares sobre la miocarditis después de la vacunación, el análisis encontró un riesgo incremental continuo de miocarditis después de la vacunación de refuerzoDe hecho, mientras que muchos países se han abstenido de recomendar la vacunación contra el COVID en niños muy pequeños porque los riesgos no justifican los beneficios, EE.UU. es el único que la recomienda en los niños más pequeños”, dijo Verma.

Un artículo de investigación publicado el 18 de mayo estudió las medidas de control de la pandemia, que incluían mandatos de vacunas y mascarillas, así como aislamiento y rastreo de contactos, de la Universidad de Cornell, que estaba casi completamente vacunada, y descubrió que estas políticas “no eran compatibles” con el Variante Omicron y su rápida propagación.

Síndrome de muerte súbita del adulto

Recientemente, un nuevo término ha sido destacado en los medios de comunicación: “síndrome de muerte súbita del adulto” o SADS.

Los factores subyacentes del SADS incluyen  miocarditis no diagnosticada, afecciones inflamatorias y otras afecciones que causan irregularidades en el sistema eléctrico del corazón, lo que desencadena un paro cardíaco.

Los datos recopilados por el Comité Olímpico Internacional muestran 1.101 muertes súbitas en atletas menores de 35 años entre 1966 y 2004, lo que arroja una tasa anual promedio de 29 en todos los deportes. Mientras tanto, solo entre marzo de 2021 y marzo de 2022, en un solo año, al menos 769 atletas sufrieron un paro cardíaco, colapsaron o murieron en el campo de juego en todo el mundo.

El danés Christian Eriksen es llevado en una camilla después de colapsar en el campo durante el partido del grupo B del campeonato de fútbol Euro 2020 entre Dinamarca y Finlandia en el Parken Stadium en Copenhague, el 12 de junio de 2021. (Stuart Franklin/Pool vía AP)

El danés Christian Eriksen es llevado en una camilla después de colapsar en el campo durante el partido del grupo B del campeonato de fútbol Euro 2020 entre Dinamarca y Finlandia en el Parken Stadium en Copenhague, el 12 de junio de 2021. (Stuart Franklin/Pool vía AP)

Entre los atletas de la FIFA (fútbol) de la UE, la muerte súbita aumentó en un 420 por ciento en 2021. Históricamente, alrededor de cinco jugadores de fútbol han muerto mientras jugaban al futbol cada año. Entre enero y mediados de noviembre de 2021, 21 jugadores de la FIFA fallecieron de muerte súbita.

Joseph Mercola contribuyó a este artículo. 

The Epoch Times contactó con los CDC para los comentarios.

Ver comentarios